Data: Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord

We used a research vessel to sample 5 sites for a total of 15 samples, sampling 3 depths per site (3-m, chlorophyll a maximum and 85-m, unless sea floor was shallower). Shallow and intermediate samples between 3-m and 12-m represent ~35-L of water filtered in-situ using long tubing and a peristaltic pump, and all other deeper samples were taken from a total of 3 Niskin bottles (General Oceanics), representing 22-L of water sampled per sample.

Water was filtered through a VigiDNA filtration capsule (SPYGEN) with a 0.20-µm pore size using an Athena peristaltic pump (Proactive Environmental Products, Bradenton, Florida) with a flow rate of ~1-L/min. Each sample was handled with single use tubing and gloves. **Molecular** To perform the amplification, we used two sets of primers: teleo (forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG; Valentini et al. 2016) and the universal eukaryotic 1389F/1510R primer pair, amplifying the V9-18S rDNA gene (Amaral-Zettler et al. 2009) (forward: TTGTACACACCGCCC, reverse: CCTTCYGCAGGTTCACCTAC). # Data content: + Metabarcoding data: This zip file contains the 2 sequencing libraries filtered to only retain the samples used in the present study. + Code, data and figure: This zip file contains all data and code to reproduce the figures and the analysis in the study, with an associated README explaining the content of each folder. # Additional informations For more details, please see the Methods in the associated publication: DOI: 10.1007/s00300-023-03187-9.