Environmental DNA Freshwater Switzerland VaudCatchment Modipl 2020

In total, 180 L were sampled in total per catchment. A filtration device composed of either the Athena® peristaltic pump (Proactive Environmental Products LLC; 1 L/min nominal flow) or the Subspace® underwater peristaltic pump (Subspace Pictures; 1 L/min nominal flow), combined with a VigiDNA® 0.2 µM cross-flow filtration capsule (VigiDNA, SPYGEN) was used in order to filter a large water volume. We used a finer mesh than the recommended VigiDNA® 0.45 µM cross-flow filtration capsule to maximise the capture of biological material since mountain water does not transport high quantities of sediments.

For each filtration capsule, we used disposable sterile tubing. At the end of each filtration, we emptied the water inside the capsules, replaced it with 80 ml of CL1 conservation buffer (SPYGEN), and stored it at room temperature. We followed a strict contamination control protocol in both field and laboratory stages (Goldberg et al. 2016; Valentini et al. 2016).

Each water sample was processed using disposable gloves and single-use filtration equipment. We used two primer sets targeting vertebrates (Vert01, forward: − TTAGATACCCCACTATGC, reverse: − TAGAACAGGCTCCTCTAG, mean marker length: 97 bp) and spermatophytes (g-h/Sper01, forward: − GGGCAATCCTGAGCCAA, reverse: CCATTGAGTCTCTGCACCTATC, mean marker length: 48 bp). Though both primers are relatively broad with low species-level resolution, we selected them as the goal was to minimise cost and effort and maximise the identification of a broad range of taxa which can represent the species assemblages of the region.

Libraries were prepared with ligation using the MetaFast protocol (Fasteris).