Data · dataset · 2025
Whole-Genome Sequencing Identifies Cryptic HOXD13 Variants in Syndactyly Pedigrees
Listed in Teesside University Research Data Repository
Genetic analysis was performed on three large syndactyly pedigrees with diverse clinical manifestations using whole-exome sequencing (WES) combined with whole-genome sequencing (WGS).
Description
WGS was conducted on probands following negative WES results. Identified pathogenic variants were validated by Sanger sequencing.
Integrated WES and WGS analyses identified three novel HOXD13 variants: one 2-bp heterozygous deletion (c.314_315delAA, p.K105fs*131), and two heterozygous polyalanine expansions (PAE)—a 27-bp polyalanine duplication (c.186_212dupGGCGGCTGCGGCGGCGGCGGCGGCAGC, p.Ala63_Ala71dupAAAAAAAAA) and a 24-bp polyalanine insertion (c.203_204insAGCAGCGGCGGCTGCGGCGGCGGC, p.Ala64_Ala71dupAAAAAAAA). WGS successfully identified cryptic variants undetectable by WES technology.
Links
Where it is published
- DOI doi.org/10.17632/k874td4pfc.1 ↗
DOI / persistent id · from researchdata tees ac uk
Catalogue records · 1
- OAI-PMH record data.mendeley.com/oai?verb=GetRecord&metadataPrefix=oai_dc&identifier=oai%3Adata… ↗
metadata API · from researchdata tees ac uk
Topics
- From keywords
- Earth & Environmental Science · Genetics · Life Sciences
- Inferred from text
- Genome sequencing 65% · Sequencing 75%
Provenance · 1 source records, 10 field assertions
| Source | Key | Last seen | Raw |
|---|---|---|---|
| Teesside University Research Data Repository | oai:data.mendeley.com/k874td4pfc.1 | 19 h ago | JSON v1 |
| Field | Assertion | Extractor | Evidence |
|---|---|---|---|
| access_level | source · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | |
| concepts[field].anzsrc:group:3105 | mapping · researchdata tees ac uk | vocabulary-mapper@1.0.0 | keywords['Genetics'] |
| concepts[field].local:field:earth-environmental | mapping · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | |
| concepts[field].local:field:life-sciences | mapping · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | |
| concepts[modality].local:modality:genome-sequencing | enrichment · researchdata tees ac uk | keyword-concept-rules@1.0.0 | title+description (65%) |
| concepts[modality].local:modality:sequencing | enrichment · researchdata tees ac uk | keyword-concept-rules@1.0.0 | title+description (75%) |
| description | source · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | /metadata/dc/description |
| license | source · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | /metadata/dc/rights |
| publication_date | source · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | |
| title | source · researchdata tees ac uk | connector:researchdata_tees_ac_uk@1.0.0 | /metadata/dc/title |